dok7

Ensembl ID:
ENSDARG00000060236
ZFIN ID:
ZDB-GENE-090312-103
Description:
Novel protein similar to H.sapiens DOK7, docking protein 7 (DOK7) [Source:UniProtKB/TrEMBL;Acc:B7ZDE
Human Orthologue:
DOK7
Human Description:
docking protein 7 [Source:HGNC Symbol;Acc:26594]
Mouse Orthologue:
Dok7
Mouse Description:
docking protein 7 Gene [Source:MGI Symbol;Acc:MGI:3584043]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45078 Nonsense Mutation detected in F1 DNA During 2018
sa45077 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084665 Nonsense 19 663 2 11
ENSDART00000135369 Nonsense 19 394 2 7
ENSDART00000137166   None 95 None 2
Genomic Location (Zv9):
Chromosome 1 (position 41572857)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40489098
GRCz11 1 41191885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCCATGTTCGAACTCTGCCTTTGTTTTGTTTCCTTACGTTAACAGTG[G/A]AAAAACAGATGGGTGATTCTTCGGAAACCTTCGCCGGTAGCAGGTAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084665 Nonsense 527 663 7 11
ENSDART00000135369   None 394 None 7
ENSDART00000137166   None 95 None 2
Genomic Location (Zv9):
Chromosome 1 (position 41536675)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40452916
GRCz11 1 41155703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCCACCACAACACGCTTACAACCCATCATCTGTCCTGACTGTGGCGGA[C/T]GAAAGGTCATTTCAAAATTGTTTTTATGTTGATTTATCGATATATTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link