si:dkey-266h18.3

Ensembl ID:
ENSDARG00000060202
ZFIN ID:
ZDB-GENE-091204-164
Human Orthologue:
HERC1
Human Description:
hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1
Mouse Orthologue:
Herc1
Mouse Description:
hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1

Alleles

There are 13 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45729 Nonsense Mutation detected in F1 DNA During 2018
sa14833 Nonsense Mutation detected in F1 DNA During 2018
sa8724 Nonsense Mutation detected in F1 DNA During 2018
sa23857 Nonsense Available for shipment Available now
sa37237 Essential Splice Site Available for shipment Available now
sa12041 Nonsense Available for shipment Available now
sa14127 Nonsense Available for shipment Available now
sa37236 Nonsense Mutation detected in F1 DNA During 2018
sa32335 Essential Splice Site Available for shipment Available now
sa11095 Essential Splice Site Available for shipment Available now
sa29524 Nonsense Mutation detected in F1 DNA During 2018
sa45728 Nonsense Mutation detected in F1 DNA During 2018
sa15596 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084553 Nonsense 343 3080 2 46
ENSDART00000133320   None 289 None 1
ENSDART00000145425 Nonsense 29 195 1 3
Genomic Location (Zv9):
Chromosome 21 (position 8274985)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9929174
GRCz11 21 10021907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAGACGGACTCTGCAGCCTCTCGCATGTTGCTCTCTGCCTTTTCGAA[G/T]AGGTCTGTTTGTGCAAAGTGTTTACAGACTGTAATATAAGCTTTTATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084553 Nonsense 567 3080 6 46
ENSDART00000133320   None 290 None 1
ENSDART00000145425   None 195 None 3
Genomic Location (Zv9):
Chromosome 21 (position 8267057)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9937012
GRCz11 21 10029493
KASP Assay ID:
1641-0490.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGCCAACTCTKGTGAAGGACATTAGCGGGGYCGGGCAGGTGGCCTGT[G/T]GAAGCTCACACACCATCGCTGTGGCTCAGGACGGACGAATCGTCTGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8724
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084553 Nonsense 968 3080 14 46
ENSDART00000133320   None 290 None 1
ENSDART00000145425   None 195 None 3
Genomic Location (Zv9):
Chromosome 21 (position 8250439)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9953630
GRCz11 21 10046111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCATACTCAGGAGCGTGCATTTGGGGAACTGGAGAAGAACAGTGATAAA[C/T]AGCGKTTCAGTCAATCCCAGAAACAGACGGAGGCTCCATCCCACTTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23857
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084553 Nonsense 1305 3080 20 46
ENSDART00000133320   None 290 None 1
ENSDART00000145425   None 195 None 3
Genomic Location (Zv9):
Chromosome 21 (position 8244063)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9960006
GRCz11 21 10052487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAATATATCAGGTGGTGTATAAAATCCGCAACACGCTGATGGCCTAT[A/T]AAGAGAGCATAGGAAACACAACCAGTGCCCAAGCACCATCTTCCACCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084553 Essential Splice Site 1662 3080 26 46
ENSDART00000133320   None 290 None 1
ENSDART00000145425   None 195 None 3
Genomic Location (Zv9):
Chromosome 21 (position 8230222)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9973847
GRCz11 21 10066328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTACCGGCAGTTTAGCAGCTCCTAACAACAAAATTCATCATTACACC[G/A]TGAGACATACAAATGATGATGGTTGCTTGAACACAAACGACATAAATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12041
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084553 Nonsense 1684 3080 27 46
ENSDART00000133320   None 290 None 1
ENSDART00000145425   None 195 None 3
Genomic Location (Zv9):
Chromosome 21 (position 8230054)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9974015
GRCz11 21 10066496
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCTATCAGTGTTCAGAGAGAGCTACAGTGTGCAGCTCATATGCTYTA[T/A]CAGCAGCTGGTGCGTGTGCTCAGGCAGAAGGTGGCTCTAGAGAGAGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14127
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084553 Nonsense 1731 3080 28 46
ENSDART00000133320   None 290 None 1
ENSDART00000145425   None 195 None 3
Genomic Location (Zv9):
Chromosome 21 (position 8228494)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9975575
GRCz11 21 10068056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTGAATTTCCACTATCAGCCGGTGGATCTGGTGGTGATTATTAAATG[T/A]GGCRTCCTGGAGATCTTGTCCACGCTGACTGATAACACCTGTGTGCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37236
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084553 Nonsense 2057 3080 33 46
ENSDART00000133320   None 290 None 1
ENSDART00000145425   None 195 None 3
Genomic Location (Zv9):
Chromosome 21 (position 8221556)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9982513
GRCz11 21 10074994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCACCACTACAGACATGTGGCTGTACAGGGCCTACAGCGGCAGCCTGTA[T/A]CATGGAGGAGAACTGGGTCGAGCCCTGCCCTCCTTCACACAGGGCGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084553 Essential Splice Site 2093 3080 33 46
ENSDART00000133320   None 290 None 1
ENSDART00000145425   None 195 None 3
Genomic Location (Zv9):
Chromosome 21 (position 8221447)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9982622
GRCz11 21 10075103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCCTGGACATGGAGGCTCGAACCATCTCCTTCGCCAAGAACAACAGG[G/A]TCAGTGTGTGTTTTTATGCATTCAATAACCATTTAACACATACCAGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11095
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084553 Essential Splice Site 2121 3080 34 46
ENSDART00000133320   None 290 None 1
ENSDART00000145425   None 195 None 3
Genomic Location (Zv9):
Chromosome 21 (position 8220002)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9984067
GRCz11 21 10076548
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGCTYTACCCGTGTGTTCTCTTYTACAGCAGTAACCCAGGAGAAAAGG[T/G]CACCATACACTCCCACATTTACGTCATGCTATTTAAATGAAAAGTACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29524
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084553 Nonsense 2270 3080 36 46
ENSDART00000133320   None 290 None 1
ENSDART00000145425   None 195 None 3
Genomic Location (Zv9):
Chromosome 21 (position 8217403)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9986666
GRCz11 21 10079147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACAGCGGCCTTCGTGCTGGAGGAACCTGCCTGCACAAATCCAGCGGC[C/T]GACGAGCCACACTGCTCGGGGTCTTGAAAGAGGGAAGCCCCCTGGCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45728
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084553 Nonsense 2289 3080 36 46
ENSDART00000133320   None 289 None 1
ENSDART00000145425   None 195 None 3
Genomic Location (Zv9):
Chromosome 21 (position 8217345)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9986724
GRCz11 21 10079205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACTGCTCGGGGTCTTGAAAGAGGGAAGCCCCCTGGCCAAACTGCAGT[G/A]GGAGGAGACAGACTTCACTGTGAGGTAAGCACACAACATTTCTTTTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15596
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084553 Nonsense 2887 3080 44 46
ENSDART00000133320   None 290 None 1
ENSDART00000145425   None 195 None 3
Genomic Location (Zv9):
Chromosome 21 (position 8196353)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 10007716
GRCz11 21 10100197
KASP Assay ID:
2261-5246.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTSTSTCAGGGAAGAGAAGAGCACCCAGAGCCACATGAGATGGTGGAGTG[T/A]GAGCTGTGTAACACACTCACCCTGCAGTTCAACAACCACAYGAAGCGCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Iris characteristics: GWAS findings for human iris patterns: associations with variants in genes that influence normal neuronal pattern development. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link