
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
atp2c1
- Ensembl ID:
- ENSDARG00000060197
- ZFIN ID:
- ZDB-GENE-060503-615
- Description:
- Novel protein similar to vertebrate ATPase, Ca++ transporting, type 2C, member 1 (ATP2C1) [Source:Un
- Human Orthologue:
- ATP2C1
- Human Description:
- ATPase, Ca++ transporting, type 2C, member 1 [Source:HGNC Symbol;Acc:13211]
- Mouse Orthologue:
- Atp2c1
- Mouse Description:
- ATPase, Ca++-sequestering Gene [Source:MGI Symbol;Acc:MGI:1889008]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12710 | Nonsense | Available for shipment | Available now |
sa17127 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12710
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084528 | Nonsense | 201 | 922 | 8 | 27 |
- Genomic Location (Zv9):
- Chromosome 16 (position 44391964)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 41672472 GRCz11 16 41622504 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATCTGGCAGTTGACGAGTCCAGTTTGAYAGGTGAAACGACCCCCTGCACC[A/T]AGACCTCTGCCCCTCAACCGGCTGCCACCAATGGCGATATCGCWTCCCGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17127
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084528 | Nonsense | 516 | 922 | 17 | 27 |
- Genomic Location (Zv9):
- Chromosome 16 (position 44375024)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 41655532 GRCz11 16 41605564 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCAAAGGCGTCACTATGCCTCTRAACAATCAGCAGAGAGACTTCTACCAA[C/T]AGCAGAAGAGCTACATGGGCTCTGGCGGTCTTAGAGGTAAATATTTGTCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: