zgc:153465

Ensembl ID:
ENSDARG00000060192
ZFIN ID:
ZDB-GENE-060929-444
Description:
RNA pseudouridylate synthase domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q08C69]
Human Orthologue:
RPUSD1
Human Description:
RNA pseudouridylate synthase domain containing 1 [Source:HGNC Symbol;Acc:14173]
Mouse Orthologue:
Rpusd1
Mouse Description:
RNA pseudouridylate synthase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1919186]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12752 Nonsense Available for shipment Available now
sa18540 Nonsense Available for shipment Available now
sa15664 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12752
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084549 Nonsense 28 293 2 7
ENSDART00000146529 Nonsense 28 293 2 6
Genomic Location (Zv9):
Chromosome 3 (position 35627837)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35413033
GRCz11 3 35542541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGTATCAMAGTWCAAACTATATAGTTGTCAACAAACACTGGGACRTT[C/T]GAATTGACAGTAAAATGTGGTATGAGAAGCAGACTGTCCAGAGTCAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18540
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084549 Nonsense 153 293 5 7
ENSDART00000146529 Nonsense 153 293 5 6
Genomic Location (Zv9):
Chromosome 3 (position 35630243)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35415439
GRCz11 3 35544947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTWGWGAGAATCCAAAGCCATGCCAAACAGAGGTCACAGTTTTAGAGTA[C/A]GGCAYGTATGATGGAGATCCAGTYACAAAAGTGCTTCTGCAGCCTCWGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084549 Nonsense 236 293 6 7
ENSDART00000146529 Nonsense 236 293 6 6
Genomic Location (Zv9):
Chromosome 3 (position 35634061)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35419257
GRCz11 3 35548765
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCACKTCACYGCGCCAGATCCGTTTGTACCCAGCCTTGATGCCAAATG[G/A]GCTCCTCAAAGATGYGTGAACATTCTGGAGGATTTACTGAAGAATATTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link