zgc:153027

Ensembl ID:
ENSDARG00000060189
ZFIN ID:
ZDB-GENE-060929-748
Description:
endothelial cell-specific molecule 1 [Source:RefSeq peptide;Acc:NP_001070209]
Human Orthologue:
ESM1
Human Description:
endothelial cell-specific molecule 1 [Source:HGNC Symbol;Acc:3466]
Mouse Orthologue:
Esm1
Mouse Description:
endothelial cell-specific molecule 1 Gene [Source:MGI Symbol;Acc:MGI:1918940]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11057 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11057
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084545 Nonsense 80 179 1 3
Genomic Location (Zv9):
Chromosome 21 (position 8305752)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9898407
GRCz11 21 9991140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGGTGAGCACTGCTACCGCACCGTCTCCGGGATGCATGGCGTCAAGTG[C/A]GGACCGGGACTCTTCTGCGACTTCTACAAGGATGMGGATGATTATGGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link