slco1d1

Ensembl ID:
ENSDARG00000060181
ZFIN ID:
ZDB-GENE-030131-5044
Description:
solute carrier organic anion transporter family, member 1D1 [Source:RefSeq peptide;Acc:NP_001082802
Human Orthologues:
AC087309.1, SLCO1B1, SLCO1B3
Human Descriptions:
liver-specific organic anion transporter 3TM12 [Source:RefSeq peptide;Acc:NP_001009562]
solute carrier organic anion transporter family, member 1B1 [Source:HGNC Symbol;Acc:10959]
solute carrier organic anion transporter family, member 1B3 [Source:HGNC Symbol;Acc:10961]
Mouse Orthologue:
Slco1b2
Mouse Description:
solute carrier organic anion transporter family, member 1b2 Gene [Source:MGI Symbol;Acc:MGI:1351899]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30489 Nonsense Mutation detected in F1 DNA During 2018
sa38230 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30489
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084568   None 599 None 12
ENSDART00000127944 Nonsense 418 682 8 13
Genomic Location (Zv9):
Chromosome Zv9_NA995 (position 22832)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76022734
GRCz11 4 77407436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTGGCGTCGGTTCTGGCTTTCTGTTCAATGCTCATCCAGTATTTCCTA[C/T]AGTGTGACAACTCACAAGTGGCGGGACTTACAGTCACGTACCAAGGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38230
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084568 Nonsense 536 599 12 12
ENSDART00000127944 Nonsense 619 682 13 13
Genomic Location (Zv9):
Chromosome Zv9_NA995 (position 39009)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76006265
GRCz11 4 77390967
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAAGCACCGTTTTTGTCTTTCAGGAATGCTTTCTTGGGGTTAATTTA[C/A]GCCCTGTACAGCTCATCCTACCTGCTGTTTGGACTTCTCTACAACAGACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link