
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:153341
- Ensembl ID:
- ENSDARG00000060176
- ZFIN ID:
- ZDB-GENE-061013-313
- Description:
- RNA (guanine-9-)-methyltransferase domain-containing protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q08B
- Human Orthologue:
- RG9MTD3
- Human Description:
- RNA (guanine-9-) methyltransferase domain containing 3 [Source:HGNC Symbol;Acc:26454]
- Mouse Orthologue:
- Rg9mtd3
- Mouse Description:
- RNA (guanine-9-) methyltransferase domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1917184]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20860 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20860
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084503 | Essential Splice Site | 50 | 310 | 1 | 8 |
- Genomic Location (Zv9):
- Chromosome 7 (position 8616423)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 7563888 GRCz11 7 7797257 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACGTGGAGCTCGAGCACGCGCGTGACGACAGAGAGGAGAGCGCGCGCTCG[G/A]TAATATTTCATAATATTTTTAGTTTTCCAGGACCTCTAAGTACGAGATTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: