zgc:153341

Ensembl ID:
ENSDARG00000060176
ZFIN ID:
ZDB-GENE-061013-313
Description:
RNA (guanine-9-)-methyltransferase domain-containing protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q08B
Human Orthologue:
RG9MTD3
Human Description:
RNA (guanine-9-) methyltransferase domain containing 3 [Source:HGNC Symbol;Acc:26454]
Mouse Orthologue:
Rg9mtd3
Mouse Description:
RNA (guanine-9-) methyltransferase domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1917184]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20860 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084503 Essential Splice Site 50 310 1 8
Genomic Location (Zv9):
Chromosome 7 (position 8616423)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 7563888
GRCz11 7 7797257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTGGAGCTCGAGCACGCGCGTGACGACAGAGAGGAGAGCGCGCGCTCG[G/A]TAATATTTCATAATATTTTTAGTTTTCCAGGACCTCTAAGTACGAGATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link