
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mns1
- Ensembl ID:
- ENSDARG00000060169
- ZFIN ID:
- ZDB-GENE-030521-42
- Description:
- Meiosis-specific nuclear structural protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6PBA8]
- Human Orthologue:
- MNS1
- Human Description:
- meiosis-specific nuclear structural 1 [Source:HGNC Symbol;Acc:29636]
- Mouse Orthologue:
- Mns1
- Mouse Description:
- meiosis-specific nuclear structural protein 1 Gene [Source:MGI Symbol;Acc:MGI:107933]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44669 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa44669
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084493 | Essential Splice Site | 285 | 486 | 6 | 10 |
ENSDART00000127006 | Essential Splice Site | 302 | 503 | 6 | 10 |
The following transcripts of ENSDARG00000060169 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 34458742)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 32853082 GRCz11 7 33124232 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCCAAAGTCAGAGAACGAGAGCAGGCAAAGGAGACCCTGCACAAAATGG[T/G]ACTTGACAGCTCAAATTATGCTCCATCAAACACAGGAAAGCAGGCAAGAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: