zgc:153346

Ensembl ID:
ENSDARG00000060120
ZFIN ID:
ZDB-GENE-061013-308
Description:
Glycerate kinase [Source:UniProtKB/Swiss-Prot;Acc:Q08BL7]
Human Orthologue:
GLYCTK
Human Description:
glycerate kinase [Source:HGNC Symbol;Acc:24247]
Mouse Orthologue:
Glyctk
Mouse Description:
glycerate kinase Gene [Source:MGI Symbol;Acc:MGI:2444085]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16932 Essential Splice Site Available for shipment Available now
sa20797 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16932
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084393 Essential Splice Site 94 502 2 5
Genomic Location (Zv9):
Chromosome 6 (position 42956400)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 43027454
GRCz11 6 43024990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTGTGCCACATGGTATCCAAAATACACWGCGCAGTCAYGGCAAAGAG[T/G]AAGTATTTTAAATGATNNNNNNNNNNNNNNNNNNNNNNCTTTTATTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20797
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084393 Essential Splice Site 144 502 3 5
Genomic Location (Zv9):
Chromosome 6 (position 42954677)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 43025731
GRCz11 6 43023267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGCCAGCAGTCTGACTGAGAAAGATCTGCTGCTTGTGCTCATTTCAG[G/A]TACTATTTGGATACTATTAGGATACTGATTTGCGAAAAAAACACTTTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link