zgc:158367

Ensembl ID:
ENSDARG00000060113
ZFIN ID:
ZDB-GENE-061215-52
Description:
hypothetical protein LOC571403 [Source:RefSeq peptide;Acc:NP_001073523]
Human Orthologue:
ZNF395
Human Description:
zinc finger protein 395 [Source:HGNC Symbol;Acc:18737]
Mouse Orthologue:
Zfp395
Mouse Description:
zinc finger protein 395 Gene [Source:MGI Symbol;Acc:MGI:2682318]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42900 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1426 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42900
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084386   60 432 3 10
ENSDART00000133154 Essential Splice Site 64 68 None 5
ENSDART00000136059   64 436 3 10
ENSDART00000138734   64 167 3 5

The following transcripts of ENSDARG00000060113 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 15937655)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16088483
GRCz11 17 16096416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGATATGTTTCAGGTGTATGTGCACTGCGGAGGCCAGGAATGTGGAGG[T/C]GTGGTGGAACAGCATAACCACGTGGACAACGAGGTGTCGATCTTCCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084386 Essential Splice Site 245 432 6 10
ENSDART00000133154   None 68 None 5
ENSDART00000136059 Essential Splice Site 249 436 6 10
ENSDART00000138734   None 167 None 5

The following transcripts of ENSDARG00000060113 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 15941724)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16092552
GRCz11 17 16100485
KASP Assay ID:
554-1347.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACCACAGTAGTGGGCATCAAACGTCACATCCGAAATTCTCATCTTGG[G/A]TAAGCATCACAMACATGACAATAACCTAACAGCAGTGTCTAACCAACACA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link