zgc:165481

Ensembl ID:
ENSDARG00000060092
ZFIN ID:
ZDB-GENE-070615-21
Description:
hypothetical protein LOC100073327 [Source:RefSeq peptide;Acc:NP_001092234]
Human Orthologue:
RNF182
Human Description:
ring finger protein 182 [Source:HGNC Symbol;Acc:28522]
Mouse Orthologue:
Rnf182
Mouse Description:
ring finger protein 182 Gene [Source:MGI Symbol;Acc:MGI:3045355]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40957 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40957
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084355 Nonsense 79 255 2 2
Genomic Location (Zv9):
Chromosome 7 (position 39849634)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38186274
GRCz11 7 38457532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATTCTGGACATGGGGGATGGTTCCAGTTCCATCAGCTGCCCTTTCTG[T/A]CGTCACGAGACGCAGGTCAGTGAGTTTGAAGTGGCTGGGCTGCCAGATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lymphoma: Susceptibility loci associated with specific and shared subtypes of lymphoid malignancies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link