zgc:153739

Ensembl ID:
ENSDARG00000060072
ZFIN ID:
ZDB-GENE-060929-958
Description:
hypothetical protein LOC767807 [Source:RefSeq peptide;Acc:NP_001070242]
Human Orthologue:
ABI3
Human Description:
ABI family, member 3 [Source:HGNC Symbol;Acc:29859]
Mouse Orthologue:
Abi3
Mouse Description:
ABI gene family, member 3 Gene [Source:MGI Symbol;Acc:MGI:1913860]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1824 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1824
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084284 Nonsense 228 454 6 9

The following transcripts of ENSDARG00000060072 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 33537649)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33271817
GRCz11 3 33403531
KASP Assay ID:
554-1816.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAGTTCGAGTTTTGGTATAGCTGTGCCACCTCCTGTAGTGCCCAGCT[G/A]GCCCACCAGCCCTGATAGTGACATCATCRGCACACTATCGGAAGAAGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link