zgc:158399

Ensembl ID:
ENSDARG00000060065
ZFIN ID:
ZDB-GENE-070209-122
Description:
hypothetical protein LOC570789 [Source:RefSeq peptide;Acc:NP_001075950]
Human Orthologue:
UBAP2
Human Description:
ubiquitin associated protein 2 [Source:HGNC Symbol;Acc:14185]
Mouse Orthologue:
Ubap2
Mouse Description:
ubiquitin-associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:1916176]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13907 Nonsense Available for shipment Available now
sa10282 Nonsense Available for shipment Available now
sa41287 Nonsense Mutation detected in F1 DNA During 2018
sa30905 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa13907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084241 Nonsense 220 1046 8 26
ENSDART00000136234 Nonsense 220 1046 9 27
ENSDART00000137104   None 78 None 4
Genomic Location (Zv9):
Chromosome 8 (position 47216715)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 45298498
GRCz11 8 45306377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGACYTGACTGTMCTTTCAGGAGCCTGGAAAGACAAWCTGGAAGAYTG[G/A]GCTGCTGAAGACTGGAACGAAGATGTGAGTGAGCTGTTAWWATTAAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10282
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084241 Nonsense 239 1046 9 26
ENSDART00000136234 Nonsense 239 1046 10 27
ENSDART00000137104   None 78 None 4
Genomic Location (Zv9):
Chromosome 8 (position 47216576)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 45298637
GRCz11 8 45306516
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTCTTTCATTCATCAGCTATCCGAGACCAAAGTGTTCACCGCTTCCTA[T/A]GCTCTTAGCTCCAAAAACCACATGGAACCTGGYCAGGGGTGAGTGCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41287
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084241 Nonsense 526 1046 14 26
ENSDART00000136234 Nonsense 526 1046 15 27
ENSDART00000137104   None 78 None 4
Genomic Location (Zv9):
Chromosome 8 (position 47207742)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 45307471
GRCz11 8 45315350
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTTTTTATTTTTTTCTTATTATTATTATTCCCATTTTAGTGAGTCTT[T/A]AGGTAGCTTGCCTCCAGCAGCAATGGAGCCCAGTTACCCCTCAGCATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30905
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084241 Nonsense 747 1046 20 26
ENSDART00000136234 Nonsense 747 1046 21 27
ENSDART00000137104   None 78 None 4
Genomic Location (Zv9):
Chromosome 8 (position 47203665)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 45311548
GRCz11 8 45319427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTGTTTTTAATCTTTGTCATCTCTTCCTGAAGCCAATCTATGGATAT[G/T]AGGATCTACAGATGATGCAGTCACGATTGCCCATGGTAACAAAGTCGTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link