zgc:158364

Ensembl ID:
ENSDARG00000060054
ZFIN ID:
ZDB-GENE-090609-1
Description:
enhancer of polycomb homolog 1 [Source:RefSeq peptide;Acc:NP_001082878]
Human Orthologue:
EPC1
Human Description:
enhancer of polycomb homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:19876]
Mouse Orthologue:
Epc1
Mouse Description:
enhancer of polycomb homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1278322]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39918 Nonsense Mutation detected in F1 DNA During 2018
sa39919 Nonsense Mutation detected in F1 DNA During 2018
sa759 Nonsense Confirmed mutation in F2 line During 2018
sa39920 Nonsense Mutation detected in F1 DNA During 2018
sa19853 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084223 Nonsense 31 797 1 14
Genomic Location (Zv9):
Chromosome 2 (position 43718121)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43767585
GRCz11 2 43605464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCTCTACCCGTCTTCCGTTGCGAGGACCTGCCCGACCTGCACGAATA[T/A]GCGTCTATTAACCGGGCAGTGCCACAGATGCCCACGGGGATGGAGAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084223 Nonsense 115 797 3 14
Genomic Location (Zv9):
Chromosome 2 (position 43725154)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43774618
GRCz11 2 43598429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAATCTGCTCTTACAGCGTTCAGTCTGGACACAGAACAGCCGGATTA[T/A]GACCTGGACTCTGAGGATGAGGCGTTTGTAAATAAGCTGAAGAAGAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa759
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084223 Nonsense 254 797 5 14
Genomic Location (Zv9):
Chromosome 2 (position 43728548)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43778012
GRCz11 2 43595093
KASP Assay ID:
554-0665.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCGTAGAGACTTAAGTCGTGCCGTCACCATCTTGGAGATGATTAAGAGA[C/T]GAGAGAAGAGCAAGAGAGAGCTGCTGCACCTCACGCTGGAGATTGTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084223 Nonsense 467 797 10 14
Genomic Location (Zv9):
Chromosome 2 (position 43731843)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43781307
GRCz11 2 43591793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGCAGGGTTTTATTGGACCGAGCCCACTCTGAATGGGATACTGTGTA[T/A]CATGGGCTGGACCCGGATTCTCCTGCATTCCCATCACTGTCTCCCACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19853
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084223 Essential Splice Site 774 797 13 14
Genomic Location (Zv9):
Chromosome 2 (position 43733951)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43783415
GRCz11 2 43589685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCTCCCAAAGGTCACCACAGGGTCAACTACCCTCGACATGGGCCCCAG[G/A]TGAGAGTCTGCCTGATCTTAAATGACTAATAACCTAGAATTCTCTCTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link