slc47a2

Ensembl ID:
ENSDARG00000060051
ZFIN ID:
ZDB-GENE-070112-1472
Description:
Multidrug and toxin extrusion protein 1 [Source:UniProtKB/Swiss-Prot;Acc:A1L1P9]
Human Orthologues:
SLC47A1, SLC47A2
Human Descriptions:
solute carrier family 47, member 1 [Source:HGNC Symbol;Acc:25588]
solute carrier family 47, member 2 [Source:HGNC Symbol;Acc:26439]
Mouse Orthologues:
Slc47a1, Slc47a2
Mouse Descriptions:
solute carrier family 47, member 1 Gene [Source:MGI Symbol;Acc:MGI:1914723]
solute carrier family 47, member 2 Gene [Source:MGI Symbol;Acc:MGI:3588190]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39346 Nonsense Mutation detected in F1 DNA During 2018
sa43708 Nonsense Mutation detected in F1 DNA During 2018
sa24016 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084237 Nonsense 156 590 4 17
Genomic Location (Zv9):
Chromosome 21 (position 38850360)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39990425
GRCz11 21 40013978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCCTCCTGCTGGCCTGTTTCCCCTGCTGGGCGCTGCTCATCAACACA[G/T]AGCCCATCCTGCTGGCTGTCCGACAGAGTCCCAATGTGGCCAGGTCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084237 Nonsense 345 590 11 17
Genomic Location (Zv9):
Chromosome 21 (position 38833350)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39973415
GRCz11 21 39996968
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGATTTGCGGTGGCCGCCAGTGTGAGGGTGGGAAATGCTCTTGGAGCT[G/T]GAAACACAGAACGAGCCAAACTGTCTGCCAAAGTAGCTTTAGTCTGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24016
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084237 Nonsense 423 590 14 17
Genomic Location (Zv9):
Chromosome 21 (position 38831028)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39971093
GRCz11 21 39994646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCTGTCTGTAGGGCATTACCGGTGGCATTGTCAGAGGTGCCGGAAAA[C/T]AGCTGCTTGGTGCTCTCTGTAACATTGTGGGATATTATTTTGTGGGATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link