zgc:195075

Ensembl ID:
ENSDARG00000060049
ZFIN ID:
ZDB-GENE-080723-70
Description:
hypothetical protein LOC100170825 [Source:RefSeq peptide;Acc:NP_001124132]
Human Orthologue:
GIMAP8
Human Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Mouse Orthologue:
Gimap8
Mouse Description:
GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40828 Nonsense Mutation detected in F1 DNA During 2018
sa20854 Nonsense Available for shipment Available now
sa20853 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084218 Nonsense 139 420 3 3
Genomic Location (Zv9):
Chromosome 7 (position 6000447)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5018819
GRCz10 7 5034965
GRCz11 7 5156845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGGAACATGTGCTTGACCACATTGTGATCTTATTCACATTTGGTGAA[C/T]AACTACAAGGAAAAACCATCGAGGAATTCATGAAGGACTGCTTAGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20854
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084218 Nonsense 187 420 3 3
Genomic Location (Zv9):
Chromosome 7 (position 6000303)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5018675
GRCz10 7 5034821
GRCz11 7 5156701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCAAATGCTGGACAAAACGTCCATGGGGCTACAGGAGCAACAAAGCT[C/T]AGGTGAAAAATCTGCTGAAAACCATTGACGAGATGGTGAATAAGAGCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20853
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084218 Nonsense 418 420 3 3
Genomic Location (Zv9):
Chromosome 7 (position 5999610)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5017982
GRCz10 7 5034128
GRCz11 7 5156008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTGGGAAGGCACAAGAGTTTGTCACTGATGCATTCAATGACAAATCA[C/T]AAACAGAATAAAATGAAAATCAGAACGAGTCGGCAGCAGTAGCCCTGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link