
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:195075
- Ensembl ID:
- ENSDARG00000060049
- ZFIN ID:
- ZDB-GENE-080723-70
- Description:
- hypothetical protein LOC100170825 [Source:RefSeq peptide;Acc:NP_001124132]
- Human Orthologue:
- GIMAP8
- Human Description:
- GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
- Mouse Orthologue:
- Gimap8
- Mouse Description:
- GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40828 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa20854 | Nonsense | Available for shipment | Available now |
sa20853 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa40828
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084218 | Nonsense | 139 | 420 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 7 (position 6000447)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 5018819 GRCz10 7 5034965 GRCz11 7 5156845 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAAGGAACATGTGCTTGACCACATTGTGATCTTATTCACATTTGGTGAA[C/T]AACTACAAGGAAAAACCATCGAGGAATTCATGAAGGACTGCTTAGAGCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20854
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084218 | Nonsense | 187 | 420 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 7 (position 6000303)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 5018675 GRCz10 7 5034821 GRCz11 7 5156701 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGCAAATGCTGGACAAAACGTCCATGGGGCTACAGGAGCAACAAAGCT[C/T]AGGTGAAAAATCTGCTGAAAACCATTGACGAGATGGTGAATAAGAGCGGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20853
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084218 | Nonsense | 418 | 420 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 7 (position 5999610)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 5017982 GRCz10 7 5034128 GRCz11 7 5156008 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTTTGGGAAGGCACAAGAGTTTGTCACTGATGCATTCAATGACAAATCA[C/T]AAACAGAATAAAATGAAAATCAGAACGAGTCGGCAGCAGTAGCCCTGTGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: