si:dkeyp-35b8.5

Ensembl ID:
ENSDARG00000060041
ZFIN IDs:
ZDB-GENE-070912-645, ZDB-GENE-070912-645
Description:
DNA ligase 1 [Source:RefSeq peptide;Acc:NP_001119860]
Human Orthologue:
LIG1
Human Description:
ligase I, DNA, ATP-dependent [Source:HGNC Symbol;Acc:6598]
Mouse Orthologue:
Lig1
Mouse Description:
ligase I, DNA, ATP-dependent Gene [Source:MGI Symbol;Acc:MGI:101789]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12017 Nonsense Available for shipment Available now
sa33012 Nonsense Mutation detected in F1 DNA During 2018
sa12131 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12017
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084174 Nonsense 662 1058 16 27
ENSDART00000127414   None 266 None 7
Genomic Location (Zv9):
Chromosome 2 (position 44389540)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44475041
GRCz11 2 44328039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCTCATATTAGTGAGATGCCAAATTATGAYGCAATCATTCCTGTAT[T/A]GCTGAAGGAGGGGATTGATGAACTGCCCAATCACTGCAAGCTCACTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084174 Nonsense 709 1058 17 27
ENSDART00000127414   None 266 None 7
Genomic Location (Zv9):
Chromosome 2 (position 44389309)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44474810
GRCz11 2 44327808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGGTGAGGTAATGAAACGTTTCGATGAAGCCTCCTTCACCTGCGAGTA[C/A]AAATATGATGGAGAGAGAGCCCAGGTGTGCTATTTTAATCTTATTCCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12131
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084174 Nonsense 936 1058 23 27
ENSDART00000127414   None 266 None 7
Genomic Location (Zv9):
Chromosome 2 (position 44365872)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44451373
GRCz11 2 44304371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTGCTGGCCTGCTATGATGAAGAGAACGAGGARTTCCAGTCTGTYTG[C/A]AAGGTGTGTTTGTGTGTGTGTAAGTGTGCATGTGGCTTGTATTCTTTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link