si:dkey-248f6.2

Ensembl ID:
ENSDARG00000060025
ZFIN ID:
ZDB-GENE-091204-32
Human Orthologue:
NELF
Human Description:
nasal embryonic LHRH factor [Source:HGNC Symbol;Acc:29843]
Mouse Orthologue:
Nelf
Mouse Description:
nasal embryonic LHRH factor Gene [Source:MGI Symbol;Acc:MGI:1861755]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23883 Essential Splice Site Available for shipment Available now
sa25152 Nonsense Mutation detected in F1 DNA During 2018
sa23882 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23883
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087766 Essential Splice Site 320 501 10 17
ENSDART00000139568 Essential Splice Site 62 123 2 6
Genomic Location (Zv9):
Chromosome 21 (position 11675852)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13377026
GRCz11 21 13473755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGAGACTGGCCTGTGAGGGAGACGACTTTATCCCTCCCAAAATTATGG[T/A]GCAGTATTGATTTAAAATGTATTTTATTGTATGGTCTAGTGTTCATTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25152
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087766 Nonsense 331 501 11 17
ENSDART00000139568 Nonsense 73 123 3 6
Genomic Location (Zv9):
Chromosome 21 (position 11673298)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13374472
GRCz11 21 13471201
KASP Assay ID:
554-7453.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAATTTGTATTTTCAGCTGATCTCATCTAAAGTTCCCAAAGCCGAATA[T/A]CTTCCCAACATCATCAAAAGAGACGATCCTTCTATTATCCCCATTCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087766 Nonsense 471 501 17 17
ENSDART00000139568   None 123 None 6
Genomic Location (Zv9):
Chromosome 21 (position 11657500)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13358674
GRCz11 21 13455403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAGAATCATATCTTCTTCTCTATTCTACCTCTCTTTTTCTTTTAGGC[A/T]AAGAAATGATTGAGATGTACTTCGACTTCCGCCTGTTTCGACTTTGGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link