zgc:153060

Ensembl ID:
ENSDARG00000060001
ZFIN ID:
ZDB-GENE-061013-752
Description:
methyltransferase-like protein 9 [Source:RefSeq peptide;Acc:NP_001070810]
Human Orthologue:
METTL9
Human Description:
methyltransferase like 9 [Source:HGNC Symbol;Acc:24586]
Mouse Orthologue:
Mettl9
Mouse Description:
methyltransferase like 9 Gene [Source:MGI Symbol;Acc:MGI:1914862]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30663 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30663
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084076 Nonsense 13 234 2 5
ENSDART00000127003 Nonsense 18 324 1 5
Genomic Location (Zv9):
Chromosome 12 (position 1196608)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 963966
GRCz11 12 999553
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTTCAGCAGATGAGGAGGCTGGTCTTCGTCTTCTGGCTGCTGTTTTA[T/A]GTGTGGTTCCTGCTGTCCATCAGGAAGATGTGGACAGGTCGGTATGTTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link