sv2c

Ensembl ID:
ENSDARG00000059997
ZFIN ID:
ZDB-GENE-060526-233
Description:
synaptic vesicle glycoprotein 2C [Source:RefSeq peptide;Acc:NP_001121811]
Human Orthologue:
SV2C
Human Description:
synaptic vesicle glycoprotein 2C [Source:HGNC Symbol;Acc:30670]
Mouse Orthologue:
Sv2c
Mouse Description:
synaptic vesicle glycoprotein 2c Gene [Source:MGI Symbol;Acc:MGI:1922459]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18001 Nonsense Available for shipment Available now
sa40545 Nonsense Mutation detected in F1 DNA During 2018
sa45226 Nonsense Mutation detected in F1 DNA During 2018
sa33695 Nonsense Available for shipment Available now
sa20517 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18001
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084024 Nonsense 367 745 4 12
Genomic Location (Zv9):
Chromosome 5 (position 47667708)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45456448
GRCz11 5 46056601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGCYGTCGTGGCCTTAACCTTCATGCCGGAGAGCCCACGCTTCTACT[T/A]GGAGGTGAGGAGCATCKCAARCCAGGKTAAAAGTTCTAATGAAAACTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40545
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084024 Nonsense 381 745 5 12
Genomic Location (Zv9):
Chromosome 5 (position 47669437)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45458177
GRCz11 5 46058330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCTCCTTTCAGGTGGGGAAGCACGACGAGGCCTGGATGATCCTCAAG[C/T]AGATTCATGACACAAACATGCGAGCGCGTGGACAGCCAGAGAAAGTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45226
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084024 Nonsense 391 745 5 12
Genomic Location (Zv9):
Chromosome 5 (position 47669467)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45458207
GRCz11 5 46058360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCTGGATGATCCTCAAGCAGATTCATGACACAAACATGCGAGCGCGT[G/T]GACAGCCAGAGAAAGTCTTCACCGTGAGTCGATTCCCTAACTTTAAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33695
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084024 Nonsense 471 745 8 12
Genomic Location (Zv9):
Chromosome 5 (position 47675387)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45464127
GRCz11 5 46064280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATTTAAAGAACTTAATATTTCTGCAGGTATTACGGTTTATCTGTGTG[G/A]TTTCCTGACGTCATCAAACACCTTCAGAACGATGAATATGCCTCTAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084024 Essential Splice Site 519 745 8 12
Genomic Location (Zv9):
Chromosome 5 (position 47675532)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45464272
GRCz11 5 46064425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCCTTGAAAACCAGATACACACTAATAGCTTATTCATCAACGACAGG[T/C]GACTTATTCCAAAGCTTAATCTTTTTATTAATGTCTGTATAAATTATCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link