
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
TRPM4 (1 of 3)
- Ensembl ID:
- ENSDARG00000059993
- Description:
- transient receptor potential cation channel, subfamily M, member 4 [Source:HGNC Symbol;Acc:17993]
- Human Orthologue:
- TRPM4
- Human Description:
- transient receptor potential cation channel, subfamily M, member 4 [Source:HGNC Symbol;Acc:17993]
- Mouse Orthologue:
- Trpm4
- Mouse Description:
- transient receptor potential cation channel, subfamily M, member 4 Gene [Source:MGI Symbol;Acc:MGI:1
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa25252 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa33216 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa25252
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083969 | Nonsense | 11 | 1194 | 3 | 29 |
- Genomic Location (Zv9):
- Chromosome 3 (position 32631562)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 32362872 GRCz11 3 32494586 - KASP Assay ID:
- 554-7636.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGCGAAAATGACTCATACTTCACTGTGTAATGTCTGCATTGTAGAGTTG[G/A]ATCCCAAAGATGATTAAAAAGAGAGTGTGCACCACCTTTGTGGAGGATTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33216
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083969 | Nonsense | 150 | 1194 | 7 | 29 |
- Genomic Location (Zv9):
- Chromosome 3 (position 32639307)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 32370617 GRCz11 3 32502331 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTAACTTTTTTTGTTGTTTTTTTCCCCCTTGTCTTTTAATGCAGGGGCTT[G/A]GATCATGACGTCAGGTCTGAAGGAGGGTGTTAGCCGTTGTGTAGGTGAGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: