zufsp

Ensembl ID:
ENSDARG00000059983
ZFIN ID:
ZDB-GENE-070209-211
Description:
zinc finger with UFM1-specific peptidase domain-like [Source:RefSeq peptide;Acc:NP_001076474]
Human Orthologue:
ZUFSP
Human Description:
zinc finger with UFM1-specific peptidase domain [Source:HGNC Symbol;Acc:21224]
Mouse Orthologue:
Zufsp
Mouse Description:
zinc finger with UFM1-specific peptidase domain Gene [Source:MGI Symbol;Acc:MGI:1919830]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39114 Nonsense Mutation detected in F1 DNA During 2018
sa42765 Nonsense Mutation detected in F1 DNA During 2018
sa22887 Missense, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084009 Nonsense 317 608 7 12
ENSDART00000141577   None 108 None 4
Genomic Location (Zv9):
Chromosome 16 (position 34505113)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32236613
GRCz11 16 32190643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTGGCTATCGGAAGCAAATGGAGAGGAATCTGGACAGGGCTGTGTCT[C/T]GAGGTCAGATGCTTCCTGCAGATTTCCACAGGAAGAGAGCGGAGATGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42765
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084009 Nonsense 336 608 7 12
ENSDART00000141577   None 108 None 4
Genomic Location (Zv9):
Chromosome 16 (position 34505171)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32236671
GRCz11 16 32190701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCTTCCTGCAGATTTCCACAGGAAGAGAGCGGAGATGCTGGAGTCTT[T/A]GGCCTCAGGGGTGGATGATGGCAGAAGCAAAACTTCAGGTCTGATTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22887
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084009 Missense 534 608 11 12
ENSDART00000141577 Nonsense 108 108 3 4
Genomic Location (Zv9):
Chromosome 16 (position 34510171)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32241671
GRCz11 16 32195701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATCAGGCCACAGTCGTTCCATCATCGGAATGGAAGAGAAAGCGAATG[G/A]TAAACTATGCCTCCTCTTCTTCGATCCGGGGGTTACACCAGCAGAAATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link