
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
wu:fj34h01
- Ensembl ID:
- ENSDARG00000059961
- ZFIN ID:
- ZDB-GENE-030131-7797
- Human Orthologue:
- CHPF2
- Human Description:
- chondroitin polymerizing factor 2 [Source:HGNC Symbol;Acc:29270]
- Mouse Orthologue:
- Chpf2
- Mouse Description:
- chondroitin polymerizing factor 2 Gene [Source:MGI Symbol;Acc:MGI:1917522]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44673 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa14922 | Nonsense | Available for shipment | Available now |
sa45290 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa44673
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083967 | Nonsense | 136 | 766 | 2 | 4 |
- Genomic Location (Zv9):
- Chromosome 7 (position 44157151)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 41147451 GRCz11 7 41427524 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAACACACTTGGGGTTGCGGTCAATAAAACAGTAGCTCACCATTTCCAT[C/T]GAACCTTCTTTTTCACTGGCCTTCGAAGTGCAAAGGCGCCACACGGCATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14922
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083967 | Nonsense | 671 | 766 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 7 (position 44162353)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 41152653 GRCz11 7 41432726 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- YTGCGTGATGGCCACTTTGACCGGCAYGTCTTYGAAGAAGCTTGTTTTTA[T/A]AACGCMGATTACATGGCTGCCCGCACAAAGATGGCGGCTGACATCCTGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45290
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083967 | Nonsense | 722 | 766 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 7 (position 44162506)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 41152806 GRCz11 7 41432879 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGGGTTGCATGTGTTTCGGGCTGTGGAGCCGGCGCTAGTACAGAAGTA[T/A]GTGCACAGGGAATGTAACCCACGCTTTAGCGAGGACATCTATCACCGCTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: