wu:fj34h01

Ensembl ID:
ENSDARG00000059961
ZFIN ID:
ZDB-GENE-030131-7797
Human Orthologue:
CHPF2
Human Description:
chondroitin polymerizing factor 2 [Source:HGNC Symbol;Acc:29270]
Mouse Orthologue:
Chpf2
Mouse Description:
chondroitin polymerizing factor 2 Gene [Source:MGI Symbol;Acc:MGI:1917522]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44673 Nonsense Mutation detected in F1 DNA During 2018
sa14922 Nonsense Available for shipment Available now
sa45290 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083967 Nonsense 136 766 2 4
Genomic Location (Zv9):
Chromosome 7 (position 44157151)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41147451
GRCz11 7 41427524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACACACTTGGGGTTGCGGTCAATAAAACAGTAGCTCACCATTTCCAT[C/T]GAACCTTCTTTTTCACTGGCCTTCGAAGTGCAAAGGCGCCACACGGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14922
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083967 Nonsense 671 766 4 4
Genomic Location (Zv9):
Chromosome 7 (position 44162353)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41152653
GRCz11 7 41432726
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTGCGTGATGGCCACTTTGACCGGCAYGTCTTYGAAGAAGCTTGTTTTTA[T/A]AACGCMGATTACATGGCTGCCCGCACAAAGATGGCGGCTGACATCCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45290
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083967 Nonsense 722 766 4 4
Genomic Location (Zv9):
Chromosome 7 (position 44162506)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41152806
GRCz11 7 41432879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGGTTGCATGTGTTTCGGGCTGTGGAGCCGGCGCTAGTACAGAAGTA[T/A]GTGCACAGGGAATGTAACCCACGCTTTAGCGAGGACATCTATCACCGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link