
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-251b21.2
- Ensembl ID:
- ENSDARG00000059960
- ZFIN ID:
- ZDB-GENE-081105-108
- Description:
- Novel protein similar to H.sapiens PLCH2, phospholipase C, eta 2 (PLCH2) [Source:UniProtKB/TrEMBL;Ac
- Human Orthologue:
- PLCH2
- Human Description:
- phospholipase C, eta 2 [Source:HGNC Symbol;Acc:29037]
- Mouse Orthologue:
- Plch2
- Mouse Description:
- phospholipase C, eta 2 Gene [Source:MGI Symbol;Acc:MGI:2443078]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34490 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa25407 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa34490
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000007624 | Nonsense | 489 | 1020 | 10 | 22 |
ENSDART00000131460 | Nonsense | 6 | 537 | 1 | 14 |
The following transcripts of ENSDARG00000059960 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 49730258)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 47582235 GRCz11 8 47571227 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCTTCTACTGTATGTGTTTGTTTGTGTTTACAGGGCAAGAAACTACCCT[C/A]AAATATAGATGAGAACGCAGAGGAGGGGGACGTGTCTGATGAAGACAGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25407
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000007624 | Nonsense | 632 | 1020 | 13 | 22 |
ENSDART00000131460 | Nonsense | 149 | 537 | 4 | 14 |
The following transcripts of ENSDARG00000059960 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 49750292)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 47602269 GRCz11 8 47591261 - KASP Assay ID:
- 554-7584.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGAGGACACCGACACCGATCAGGAGAGCTCAAGCGGGGCATCTAAAGCA[C/T]AAGCACATCACAGCAGGTACCATTTAGAATTACTCTTGATGATTAGATTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
- Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: