zgc:162591

Ensembl ID:
ENSDARG00000059951
ZFIN ID:
ZDB-GENE-030131-3825
Description:
Phospholipase D6 [Source:UniProtKB/Swiss-Prot;Acc:A3KNW0]
Human Orthologue:
PLD6
Human Description:
phospholipase D family, member 6 [Source:HGNC Symbol;Acc:30447]
Mouse Orthologue:
Pld6
Mouse Description:
phospholipase D family, member 6 Gene [Source:MGI Symbol;Acc:MGI:2687283]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa60 Missense Confirmed mutation in F2 line During 2018

Mutation Details

Allele Name:
sa60
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083946 Missense 170 227 4 4
Genomic Location (Zv9):
Chromosome 1 (position 52698661)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51569610
GRCz11 1 52203735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGTTCATATGCATCATAAGTTTGCATTAGTGGACGGCAGAAAGCTGA[T/A]CAGCGGCTCCCTCAACTGGACACTCACCGCAGTCCAGAGCAACAAGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link