slc25a47a

Ensembl ID:
ENSDARG00000059923
ZFIN ID:
ZDB-GENE-060616-266
Description:
Solute carrier family 25 member 47-A [Source:UniProtKB/Swiss-Prot;Acc:Q1ECW7]
Human Orthologue:
SLC25A47
Human Description:
solute carrier family 25, member 47 [Source:HGNC Symbol;Acc:20115]
Mouse Orthologue:
Slc25a47
Mouse Description:
solute carrier family 25, member 47 Gene [Source:MGI Symbol;Acc:MGI:2144766]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9955 Essential Splice Site Available for shipment Available now
sa19250 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9955
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083876 Essential Splice Site 108 294 4 6
ENSDART00000083876 Essential Splice Site 108 294 4 6
Genomic Location (Zv9):
Chromosome 20 (position 53989746)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53845689
GRCz11 20 53635145
KASP Assay ID:
2261-5034.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTAAGCTGGATGTCTTTATGTCCGGTCTGGCCGGTGGTGTGGCACAG[G/A]TCAGATTTACTTTWTAGGGGTCGKTCACACAGAATGYGTTATTCCATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19250
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083876 Essential Splice Site 108 294 4 6
ENSDART00000083876 Essential Splice Site 108 294 4 6
Genomic Location (Zv9):
Chromosome 20 (position 53989746)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53845689
GRCz11 20 53635145
KASP Assay ID:
2261-5034.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTAAGCTGGATGTCTTTATGTCCGGTCTGGCCGGTGGTGTGGCACAG[G/A]TCAGATTTACTTTATAGGGGTCGTTCACACAGAATGCGTTATTCCATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link