
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
TRIM69 (3 of 3)
- Ensembl ID:
- ENSDARG00000059905
- Description:
- tripartite motif-containing 69 [Source:HGNC Symbol;Acc:17857]
- Human Orthologue:
- TRIM69
- Human Description:
- tripartite motif-containing 69 [Source:HGNC Symbol;Acc:17857]
- Mouse Orthologue:
- Trim69
- Mouse Description:
- tripartite motif-containing 69 Gene [Source:MGI Symbol;Acc:MGI:1918178]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22821 | Nonsense | Available for shipment | Available now |
sa10274 | Nonsense | Available for shipment | Available now |
sa36104 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa36103 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa22820 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa22821
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083822 | Nonsense | 11 | 308 | 1 | 6 |
ENSDART00000123717 | Nonsense | 11 | 463 | 1 | 6 |
- Genomic Location (Zv9):
- Chromosome 16 (position 23984385)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 21995123 GRCz11 16 21799375 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACTACAGCAGGTGAATCATGGCTTCAGCTCTGTCTCTTTACCTCATGTG[T/A]CCGGTGTGTCTGAGTGACTTCAAAGTTCCAGTAAGTTTGCCCTGTGAACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10274
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083822 | Nonsense | 43 | 308 | 1 | 6 |
ENSDART00000123717 | Nonsense | 43 | 463 | 1 | 6 |
- Genomic Location (Zv9):
- Chromosome 16 (position 23984291)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 21995029 GRCz11 16 21799281 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GYGAACATGTTCTCTGTCGGCAGTGTGCTTCCAGGTATTTAGAATCCAGC[A/T]AAGGACCTCATAAATGCCCAGAATGCAGACAAAACTTYACCRGGACGGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36104
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083822 | Essential Splice Site | 246 | 308 | 3 | 6 |
ENSDART00000123717 | Essential Splice Site | 246 | 463 | 3 | 6 |
- Genomic Location (Zv9):
- Chromosome 16 (position 23981953)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 21992691 GRCz11 16 21796943 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATATTGGAGTCAGGACTAAAGATAAACCAGCCAGAGAGGTTTTTAGAGG[T/A]AACGTTGTTCTGTAGCACATTCCAGAAACATGTTTAGACTCAGCATGGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36103
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083822 | Nonsense | 269 | 308 | 5 | 6 |
ENSDART00000123717 | None | 463 | None | 6 |
- Genomic Location (Zv9):
- Chromosome 16 (position 23979883)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 21990621 GRCz11 16 21794873 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAATGTTAATTTTCATGAGAATGTTGCAAGTTCATAGTGCAGTCCTAGCT[C/A]AATTTCATGTGTGCAATGTTGCTGTAAACATTTTAACGGTTGTTTTCTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22820
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083822 | None | 308 | None | 6 | |
ENSDART00000123717 | Essential Splice Site | 311 | 463 | 5 | 6 |
- Genomic Location (Zv9):
- Chromosome 16 (position 23979713)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 21990451 GRCz11 16 21794703 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACCTTCCGCTCATGGTTTGGCGAGACATGCTGGGTCCTGTTAAACGAGG[T/C]GAGTTGAGCTTTCATGAACATCTCTAATAAAGAAACACATTTTTATACTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: