zgc:162584

Ensembl ID:
ENSDARG00000059902
ZFIN ID:
ZDB-GENE-050809-9
Description:
vacuolar protein sorting 16 [Source:RefSeq peptide;Acc:NP_001091659]
Human Orthologue:
VPS16
Human Description:
vacuolar protein sorting 16 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:14584]
Mouse Orthologue:
Vps16
Mouse Description:
vacuolar protein sorting 16 (yeast) Gene [Source:MGI Symbol;Acc:MGI:2136772]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20635 Nonsense Available for shipment Available now
sa14249 Nonsense Available for shipment Available now
sa20634 Nonsense Available for shipment Available now
sa7028 Nonsense Confirmed mutation in F2 line During 2018
sa40632 Nonsense Mutation detected in F1 DNA During 2018
sa7027 Nonsense Confirmed mutation in F2 line During 2018

Mutation Details

Allele Name:
sa20635
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083820 Nonsense 298 835 9 22
Genomic Location (Zv9):
Chromosome 6 (position 8680126)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8880096
GRCz11 6 9115635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGACGGGCTTCTCCTGGTGGTCGGAGAGTGTAAAGAAACAATTCAGTA[T/A]CAACTGGATGATGATTCAATCCTGGTCCCGGAGCTAGATGGGGTTCGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14249
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083820 Nonsense 353 835 10 22
Genomic Location (Zv9):
Chromosome 6 (position 8679308)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8880914
GRCz11 6 9116453
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGCCTCAATGGCTCCTGGAGCTTTACTGCTGGAGGCACATAAAGAATA[T/G]GAGGTGAGACAYATTTACTATTYAGGACAAACATTTYTTTAACCTTAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20634
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083820 Nonsense 453 835 12 22
Genomic Location (Zv9):
Chromosome 6 (position 8676309)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8883913
GRCz11 6 9119452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGACCCACACTCAGTTCAAGCAGATGACCGTACAGGTGCTCATCGAC[A/T]GGTGAATAGGCTGTTTGAGGGGGCAAGGATTTCACTTTATTGGAATAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7028
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083820 Nonsense 460 835 13 22
Genomic Location (Zv9):
Chromosome 6 (position 8676192)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8884030
GRCz11 6 9119569
KASP Assay ID:
554-4968.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATRTATGACTTTTAYCTCTGTTTTATTAGATTGGTTTATCGTAAACTCTA[T/A]CCACTGGCTATTGAGGTTTGCAGATATCTGAAGACTCCGGAATATCAGGG
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Entity Quality Tag
Hatching:Long-pec
ZFS:0000033
eye
ZFA:0000107

increased size
PATO:0000586
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
head
ZFA:0001114

increased size
PATO:0000586
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
inner ear
ZFA:0000217

increased size
PATO:0000586
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
iridophore
ZFA:0009199

absent
PATO:0000462
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
melanocyte
ZFA:0009091

quality
PATO:0000001
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
whole organism
ZFA:0001094
anterior/posterior axis
BSPO:0000013
decreased length
PATO:0000574
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa40632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083820 Nonsense 591 835 16 22
Genomic Location (Zv9):
Chromosome 6 (position 8672258)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8887964
GRCz11 6 9123503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGATGTACCTGAAGAATGAGCTAAACAGAGGAGACTTCTTCATGATGT[T/A]GAGGAACCAACCTGTGGCTCTGAGCCTCTACAGACAGGTACACACTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7027
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083820 Nonsense 635 835 17 22
Genomic Location (Zv9):
Chromosome 6 (position 8670174)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8890112
GRCz11 6 9125651
KASP Assay ID:
554-5051.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGATGACGATCACGAGGAACTGGGCAATTTCTAYGTAAAAGCCAGCTA[T/G]AAAGAGCAGGTAGGCAAAAGCTTTTTNNNTTCTAGTTCCTTTAGCAAGAA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Entity Quality Tag
Hatching:Long-pec
ZFS:0000033
eye
ZFA:0000107

increased size
PATO:0000586
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
head
ZFA:0001114

increased size
PATO:0000586
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
inner ear
ZFA:0000217

increased size
PATO:0000586
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
iridophore
ZFA:0009199

absent
PATO:0000462
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
melanocyte
ZFA:0009091

quality
PATO:0000001
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
whole organism
ZFA:0001094
anterior/posterior axis
BSPO:0000013
decreased length
PATO:0000574
abnormal
PATO:0000460

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link