tbc1d9

Ensembl ID:
ENSDARG00000059900
ZFIN ID:
ZDB-GENE-060810-33
Description:
Novel protein similar to TBC1 domain family, member 9 (TBC1D9) [Source:UniProtKB/TrEMBL;Acc:A2AW07]
Human Orthologues:
TBC1D9, TBC1D9B
Human Descriptions:
TBC1 domain family, member 9 (with GRAM domain) [Source:HGNC Symbol;Acc:21710]
TBC1 domain family, member 9B (with GRAM domain) [Source:HGNC Symbol;Acc:29097]
Mouse Orthologues:
Tbc1d9, Tbc1d9b
Mouse Descriptions:
TBC1 domain family, member 9 Gene [Source:MGI Symbol;Acc:MGI:1918560]
TBC1 domain family, member 9B Gene [Source:MGI Symbol;Acc:MGI:1924045]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32778 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32778
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083799 Essential Splice Site 485 512 11 12
ENSDART00000143909 Essential Splice Site 948 1208 18 20
Genomic Location (Zv9):
Chromosome 1 (position 53854987)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52724558
GRCz11 1 53359296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGAGAAGGACGACGGTTTCGTCAGAGTCACGTTTAAGAATGAGAAAGG[T/A]GAGAAAAAGCAGCCATTCATACCAAAACAGTTAAATAATTGATAAATAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link