LOC571410

Ensembl ID:
ENSDARG00000059899
Human Orthologue:
ADORA3
Human Description:
adenosine A3 receptor [Source:HGNC Symbol;Acc:268]
Mouse Orthologues:
Adora3, Adora3
Mouse Descriptions:
adenosine A3 receptor Gene [Source:MGI Symbol;Acc:MGI:104847]
adenosine A3 receptor Gene [Source:MGI Symbol;Acc:MGI:104847]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44648 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083823 Nonsense 263 329 2 2
Genomic Location (Zv9):
Chromosome 6 (position 54414778)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54451512
GRCz11 6 54459620
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGCCACTTCACATTATGAACAGCATTGTGTTTTTCTGCCCCACATG[C/A]AACGTGCCCAAGAGTGCTTTTTATGTGGGCATCTTCATGTCGCACATTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link