zgc:175152

Ensembl ID:
ENSDARG00000059871
ZFIN ID:
ZDB-GENE-080220-52
Description:
hypothetical protein LOC569903 [Source:RefSeq peptide;Acc:NP_001104670]
Human Orthologue:
SHARPIN
Human Description:
SHANK-associated RH domain interactor [Source:HGNC Symbol;Acc:25321]
Mouse Orthologue:
Sharpin
Mouse Description:
SHANK-associated RH domain interacting protein Gene [Source:MGI Symbol;Acc:MGI:1913331]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7080 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083719 Nonsense 307 714 6 14
Genomic Location (Zv9):
Chromosome 7 (position 41469399)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39805656
GRCz11 7 40076673
KASP Assay ID:
554-4650.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACACTGCGTTCCTTTATCTCATTTCTGCCCGTCAGGCTCGTCTCAGT[C/T]GAGGGATCTACCAGCAAGATCAGGAAAGTGCTTTACTCRTGGTGCCAACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link