zgc:153684

Ensembl ID:
ENSDARG00000059870
ZFIN ID:
ZDB-GENE-060929-1126
Description:
hypothetical protein LOC767784 [Source:RefSeq peptide;Acc:NP_001070219]
Human Orthologue:
CLK2
Human Description:
CDC-like kinase 2 [Source:HGNC Symbol;Acc:2069]
Mouse Orthologue:
Clk2
Mouse Description:
CDC-like kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1098669]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36276 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36276
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083713 Nonsense 155 498 4 14
Genomic Location (Zv9):
Chromosome 16 (position 57930680)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 54665318
GRCz11 16 54484330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAGAAAGCGTGGGCGGTTAAAGACGATGAGGAGGGTCATCTGATCTA[T/A]CGGGCCGGTGATGTGCTGCAGGACAGATGTGTGTTTCTCATCACCACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link