si:dkey-65b12.4

Ensembl ID:
ENSDARG00000059855
ZFIN ID:
ZDB-GENE-060526-328
Description:
Novel protein similar to human WD repeat domain 66 (WDR66) [Source:UniProtKB/TrEMBL;Acc:A3QK38]
Human Orthologue:
WDR66
Human Description:
WD repeat domain 66 [Source:HGNC Symbol;Acc:28506]
Mouse Orthologue:
Wdr66
Mouse Description:
WD repeat domain 66 Gene [Source:MGI Symbol;Acc:MGI:1918495]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11751 Essential Splice Site Available for shipment Available now
sa20505 Essential Splice Site Available for shipment Available now
sa12207 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11751
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083665 Essential Splice Site 92 906 2 20
ENSDART00000147299 Essential Splice Site 160 906 3 18

The following transcripts of ENSDARG00000059855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 43394499)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41175764
GRCz11 5 41775917
KASP Assay ID:
2259-6335.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGGACATGGGTCAAGAGAGTCTTGWTATCATATGGGATGCTTATACAGG[G/T]TAAATCTGACCCTTTATTCTATTCCTATTGCTTTTGTAAATCCSCCCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20505
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083665 Essential Splice Site 413 906 9 20
ENSDART00000147299 Essential Splice Site 479 906 10 18

The following transcripts of ENSDARG00000059855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 43398692)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41179957
GRCz11 5 41780110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTCCTGTCCCACAAACAGATCCAGTGCATTGCCTATGATCCACAAGG[T/G]GAACGTTTCATTGTTGTATTACCATATTTTACGGGTCATTTGTTTGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12207
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083665   None 906 None 20
ENSDART00000147299 Nonsense 903 906 18 18

The following transcripts of ENSDARG00000059855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 43405822)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41187087
GRCz11 5 41787240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGATGAACTGCTTGAGCTACTGCAGGCTAGAGGTAAGTTTTTTATTTTT[A/T]AAGATTGTAATTAACAGAGAAAGATTTTGGTTACTGCATTTAAGAGGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link