zgc:162630

Ensembl ID:
ENSDARG00000059836
ZFIN ID:
ZDB-GENE-070410-90
Description:
hypothetical protein LOC561924 [Source:RefSeq peptide;Acc:NP_001076294]
Human Orthologue:
DDIT3
Human Description:
DNA-damage-inducible transcript 3 [Source:HGNC Symbol;Acc:2726]
Mouse Orthologue:
Ddit3
Mouse Description:
DNA-damage inducible transcript 3 Gene [Source:MGI Symbol;Acc:MGI:109247]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20839 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083628 Nonsense 199 242 4 4
Genomic Location (Zv9):
Chromosome 6 (position 58821181)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58924309
GRCz11 6 58918540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCACTTTGCTCTGCATCCCCTGGGAAAAAGAGCCGCAGAGAGCGCGAA[C/T]AGGAGAATGAAAGGAAAGTGCAGGAGCTGACGGATCAAAACGAGCGGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link