zfyve27

Ensembl ID:
ENSDARG00000059835
ZFIN ID:
ZDB-GENE-061013-502
Description:
zinc finger, FYVE domain containing 27 [Source:RefSeq peptide;Acc:NP_001070759]
Human Orthologue:
ZFYVE27
Human Description:
zinc finger, FYVE domain containing 27 [Source:HGNC Symbol;Acc:26559]
Mouse Orthologue:
Zfyve27
Mouse Description:
zinc finger, FYVE domain containing 27 Gene [Source:MGI Symbol;Acc:MGI:1919602]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39708 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083615   None 330 2 12
ENSDART00000126723 Nonsense 27 428 1 12
ENSDART00000137352   None 140 None 6
ENSDART00000140375 Nonsense 27 409 2 12

The following transcripts of ENSDARG00000059835 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 55432593)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54215532
GRCz11 1 54893183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTCCGCAGGCGAGCGCTGAGCGGCCTGAGCTGACCCAGCTGCCCACT[A/T]AAGACCCGTCCTGCGCAGACAGCGCCTCAGACCCGGGCAGCCCCAAAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link