zgc:163001

Ensembl ID:
ENSDARG00000059832
ZFIN ID:
ZDB-GENE-070424-99
Description:
BAI3, brain-specific angiogenesis inhibitor 3 [Source:RefSeq peptide;Acc:NP_001082879]
Human Orthologue:
BAI3
Human Description:
brain-specific angiogenesis inhibitor 3 [Source:HGNC Symbol;Acc:945]
Mouse Orthologue:
Bai3
Mouse Description:
brain-specific angiogenesis inhibitor 3 Gene [Source:MGI Symbol;Acc:MGI:2441837]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22362 Nonsense Available for shipment Available now
sa13532 Essential Splice Site Available for shipment Available now
sa10373 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22362
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111080   None 626 None 15
ENSDART00000126945 Nonsense 8 629 2 10
ENSDART00000132691   None 1216 None 28
ENSDART00000137299   None 564 None 14
ENSDART00000145292   None 164 None 6
ENSDART00000145777 Nonsense 8 250 2 2
Genomic Location (Zv9):
Chromosome 13 (position 38701718)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 38178530
GRCz11 13 38304420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCTCTTGCAGGCCAAATGACATAGGATGAAGGCTGTTCGTAATTTGT[T/A]GATTTATATATTTTCCACCTATCTCCTGGTTATGTTTGGATATACTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13532
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111080   None 626 None 15
ENSDART00000126945 Essential Splice Site 288 629 3 10
ENSDART00000132691 Essential Splice Site 38 1216 1 28
ENSDART00000137299   None 564 None 14
ENSDART00000145292   None 164 None 6
ENSDART00000145777   None 250 None 2
Genomic Location (Zv9):
Chromosome 13 (position 38827876)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 38304688
GRCz11 13 38430578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGGCCTACAGGAGCGAGATGAATCTGCTAAATTTATGGCACAAACTGG[T/A]AATACAATAGTTATGCTTCTTTCCTTTCCTATGTAAACTAAACTTAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10373
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111080   None 626 None 15
ENSDART00000126945   None 629 None 10
ENSDART00000132691 Essential Splice Site 414 1216 9 28
ENSDART00000137299   None 564 None 14
ENSDART00000145292   None 164 None 6
ENSDART00000145777   None 250 None 2
Genomic Location (Zv9):
Chromosome 13 (position 38870227)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 38347039
GRCz11 13 38472929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAATCTTCTAGAAGAGGAGAACAGAGAAAAGTGGGAAGACGCACAACAG[G/A]TGGGCCTGAACGTTTCRAGCGAGTGTTTTTGAGGCTTTGGGGTCGAGATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link