zgc:153102

Ensembl ID:
ENSDARG00000059824
ZFIN IDs:
ZDB-GENE-061013-742, ZDB-GENE-061013-742
Description:
hypothetical protein LOC564868 [Source:RefSeq peptide;Acc:NP_001104650]
Human Orthologue:
SOAT2
Human Description:
sterol O-acyltransferase 2 [Source:HGNC Symbol;Acc:11178]
Mouse Orthologue:
Soat2
Mouse Description:
sterol O-acyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:1332226]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8468 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083582 Nonsense 182 395 7 15
ENSDART00000126851 Nonsense 213 534 6 15
Genomic Location (Zv9):
Chromosome 6 (position 58654840)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58757968
GRCz11 6 58752199
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGCCACCWCAGGACCWGTGTTTGYGTCATCACTGCTATAATTCTATG[T/A]GCTGCGCAGATGAGCATGCTGGGAATATTTCCAGTCTAYGTGGTCCTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link