sin3ab

Ensembl ID:
ENSDARG00000059812
ZFIN ID:
ZDB-GENE-030131-2066
Human Orthologue:
SIN3A
Human Description:
SIN3 homolog A, transcription regulator (yeast) [Source:HGNC Symbol;Acc:19353]
Mouse Orthologue:
Sin3a
Mouse Description:
transcriptional regulator, SIN3A (yeast) Gene [Source:MGI Symbol;Acc:MGI:107157]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6085 Nonsense Mutation detected in F1 DNA During 2018
sa17152 Nonsense Available for shipment Available now
sa40996 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6085
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083555 Nonsense 532 1264 10 20
Genomic Location (Zv9):
Chromosome 7 (position 49829332)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48099568
GRCz11 7 48372344
KASP Assay ID:
554-3847.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACTTTCTTGGCTACAGAGAGTGTGCTCATATTGAGAGCTTTCCCAAA[G/T]AGCGAGCCACCGAAGGCATCGCAATGGAAATTGATTATGCATCTTGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17152
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083555 Nonsense 646 1264 12 20
Genomic Location (Zv9):
Chromosome 7 (position 49827094)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48097330
GRCz11 7 48370106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGCTGTTCAAAAGAGAATCTCACGCATGTCTGCCGAGGAACAAGCC[A/T]AATTCCGGCTGGACAACACYATCGGAGGCTCCTCAGAGGTCATYCACCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083555 Essential Splice Site 1001 1264 15 20
Genomic Location (Zv9):
Chromosome 7 (position 49820654)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48090890
GRCz11 7 48363666
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACATTGCCTTCACCATGGACAAACTCATCCAGAGTATAGTGAGACAGG[T/C]AAAGGGATTTCCTTATTTTGTTTTTGTTGTTGGTCTGCGCATTTATCATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link