zgc:158642

Ensembl ID:
ENSDARG00000059806
ZFIN ID:
ZDB-GENE-070112-542
Description:
Phosphatidylinositide phosphatase SAC1-A [Source:UniProtKB/Swiss-Prot;Acc:A1L244]
Human Orthologue:
SACM1L
Human Description:
SAC1 suppressor of actin mutations 1-like (yeast) [Source:HGNC Symbol;Acc:17059]
Mouse Orthologue:
Sacm1l
Mouse Description:
SAC1 (suppressor of actin mutations 1, homolog)-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45586 Nonsense Mutation detected in F1 DNA During 2018
sa22963 Nonsense Available for shipment Available now
sa42833 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22964 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083513 Nonsense 143 586 5 20
Genomic Location (Zv9):
Chromosome 16 (position 57141882)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53724447
GRCz11 16 53611274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGACGGTTTCTACTTCGCCACAGATTACGACCTGACGCACACATTA[C/T]AGCGGCTGTCCAACACCAGCCCAGAGTTTCAGGAGATGACCTTACTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22963
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083513 Nonsense 167 586 6 20
Genomic Location (Zv9):
Chromosome 16 (position 57142836)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53725401
GRCz11 16 53612228
KASP Assay ID:
2261-0400.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATGAATGATTTTCTGCTGTTTCTGCAGGCGGATCAGAGGTTTGTGTG[G/A]AACGGTCACCTGCTCCGAGAGTTTATGGCACAGCCGGAGGTAAAACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083513 Essential Splice Site 180 586 6 20
Genomic Location (Zv9):
Chromosome 16 (position 57142877)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53725442
GRCz11 16 53612269
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGTGTGGAACGGTCACCTGCTCCGAGAGTTTATGGCACAGCCGGAGG[T/G]AAAACACACTCACACATTCACATCAACAAACTTTACATTCAGCTGCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083513 Nonsense 263 586 10 20
Genomic Location (Zv9):
Chromosome 16 (position 57148283)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53730848
GRCz11 16 53617675
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATCTGTGTTTTTTTCCCTCAGACTCGAGGCTCCATCCCGTTCTACTG[G/A]TCTCAGAGACCAAACCTCAAATACAAACCAAAACCGCAGATCAGCAAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link