zgc:152897

Ensembl ID:
ENSDARG00000059789
ZFIN ID:
ZDB-GENE-060929-432
Description:
poly [Source:RefSeq peptide;Acc:NP_001070643]
Human Orthologue:
PARP8
Human Description:
poly (ADP-ribose) polymerase family, member 8 [Source:HGNC Symbol;Acc:26124]
Mouse Orthologue:
Parp8
Mouse Description:
poly (ADP-ribose) polymerase family, member 8 Gene [Source:MGI Symbol;Acc:MGI:1098713]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20501 Essential Splice Site Available for shipment Available now
sa45220 Nonsense Mutation detected in F1 DNA During 2018
sa40522 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20501
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083467 Essential Splice Site 220 859 9 26
ENSDART00000133183 Essential Splice Site 220 861 9 26
Genomic Location (Zv9):
Chromosome 5 (position 42502147)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40276864
GRCz11 5 40877017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTATTGTACGGCTTCACTGCTCCCTCACACAATATCTGAATGGACCAG[G/T]TTAGATGCACACAGACACAAGCAAACTTTCTGTAATACAAGATTTATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083467 Nonsense 269 859 11 26
ENSDART00000133183 Nonsense 269 861 11 26
Genomic Location (Zv9):
Chromosome 5 (position 42494131)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40268848
GRCz11 5 40869001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGAAGTGTCAGAGCAAAGATAAACTCATCAGCCCGCACAGCAAAAAG[C/T]AAACAGAGAAGAAAGTCAAGTCTCCCCTGCATATTTTTTCAACATTACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083467 Essential Splice Site 603 859 16 26
ENSDART00000133183 Essential Splice Site 603 861 16 26
Genomic Location (Zv9):
Chromosome 5 (position 42484576)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40259293
GRCz11 5 40859446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGTGGTGGATCCCAATGACTCACAAGCACTTGCCTTCAACCCCAGGG[T/A]ACTCAAAACTCTAAGAGCATTCCATTCAACCTGTCTAACGTTTAATGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link