slc32a1

Ensembl ID:
ENSDARG00000059775
ZFIN ID:
ZDB-GENE-061201-1
Description:
vesicular inhibitory amino acid transporter [Source:RefSeq peptide;Acc:NP_001074170]
Human Orthologue:
SLC32A1
Human Description:
solute carrier family 32 (GABA vesicular transporter), member 1 [Source:HGNC Symbol;Acc:11018]
Mouse Orthologue:
Slc32a1
Mouse Description:
solute carrier family 32 (GABA vesicular transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:1194

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14045 Nonsense Available for shipment Available now
sa2297 Nonsense Confirmed mutation in F2 line During 2018

Mutation Details

Allele Name:
sa14045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083453 Nonsense 12 530 1 2
Genomic Location (Zv9):
Chromosome 6 (position 59811360)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 60152176
GRCz11 6 60147084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTTTAGCAGARCAATCATGGCTACGTTAATAAGAAGCAAGATCTCGAAT[A/T]AGCTGTCCAAYGCGGCCACTACCGTCACCAATAARTCGCAGGCGAAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2297
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083453 Nonsense 248 530 2 2
Genomic Location (Zv9):
Chromosome 6 (position 59809246)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 60150062
GRCz11 6 60144970
KASP Assay ID:
554-2698.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCTGATGTACAACAGCTTCCCCACCCTCCCAGTGTCCCAGAGGTCCTG[G/A]GCCATCATCGCCACCGCCGCTCTCCTGCCTTGCGCCTTCCTCAAGAACCT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Day 4
ZFS:0000036
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
head
ZFA:0001114
malformed
PATO:0000646
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
otolith
ZFA:0001617
present in fewer numbers in organism
PATO:0001997
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
trunk
ZFA:0001115
curved
PATO:0000406
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
whole organism
ZFA:0001094
decreased size
PATO:0000587
abnormal
PATO:0000460

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link