si:dkey-56p7.8

Ensembl ID:
ENSDARG00000059770
ZFIN ID:
ZDB-GENE-060503-925
Description:
carnitine palmitoyltransferase 1A [Source:RefSeq peptide;Acc:NP_001038319]
Human Orthologue:
CPT1A
Human Description:
carnitine palmitoyltransferase 1A (liver) [Source:HGNC Symbol;Acc:2328]
Mouse Orthologue:
Cpt1a
Mouse Description:
carnitine palmitoyltransferase 1a, liver Gene [Source:MGI Symbol;Acc:MGI:1098296]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16862 Nonsense Available for shipment Available now
sa34169 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16862
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083431 Nonsense 55 777 2 18
ENSDART00000145375 Nonsense 55 774 2 18
Genomic Location (Zv9):
Chromosome 7 (position 50263691)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48533927
GRCz11 7 48806703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTTCGATTGTTGCAKTTCTACAGAATGGCATTTTGAATGGGGTATA[T/A]CCAGGAAGCGCACCAGGGTTCGTGCTGGTGYTGGCAGGGTACCTTGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34169
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083431 Essential Splice Site 259 777 6 18
ENSDART00000145375 Essential Splice Site 259 774 6 18
Genomic Location (Zv9):
Chromosome 7 (position 50268207)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48538443
GRCz11 7 48811219
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGAGAGGTCGTGGGCCAATCATGGTTAACAGCAACTATTATGTAATG[G/A]TAAATGGTGCTTGCCAGCTTCACATGTGTATGCAGCCAAAACGTGCAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link