zgc:194983

Ensembl ID:
ENSDARG00000059760
ZFIN ID:
ZDB-GENE-030131-3224
Description:
WD and tetratricopeptide repeats protein 1 [Source:RefSeq peptide;Acc:NP_001124078]
Human Orthologue:
WDTC1
Human Description:
WD and tetratricopeptide repeats 1 [Source:HGNC Symbol;Acc:29175]
Mouse Orthologue:
Wdtc1
Mouse Description:
WD and tetratricopeptide repeats 1 Gene [Source:MGI Symbol;Acc:MGI:2685541]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16269 Essential Splice Site Available for shipment Available now
sa36280 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45587 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22967 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16269
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113358 Essential Splice Site 66 674 4 16
Genomic Location (Zv9):
Chromosome 16 (position 58490383)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 55258239
GRCz11 16 54966264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGTCACTCAGGCTKTGTCAACTGTCTGGAGTGGAATGAGAAAGGAGAG[T/G]AAGTTGTGTTCAGTCTAGAGCTGTGCAAWACGAYAAACACTCMCCGGSCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36280
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113358 Essential Splice Site 297 674 9 16
Genomic Location (Zv9):
Chromosome 16 (position 58483990)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 55251846
GRCz11 16 54959871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTCAGTCCTGACGGCACCGAGCTGCTGGTCAACATGGGTGGAGAACAA[G/A]TAAAGAAACCGGTCCTGCTGTCTTTCTGCTGATGTTTTTAAGCAGAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113358 Essential Splice Site 297 674 9 16
Genomic Location (Zv9):
Chromosome 16 (position 58483989)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 55251845
GRCz11 16 54959870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAGTCCTGACGGCACCGAGCTGCTGGTCAACATGGGTGGAGAACAAG[T/C]AAAGAAACCGGTCCTGCTGTCTTTCTGCTGATGTTTTTAAGCAGAACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22967
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113358 Essential Splice Site 410 674 12 16
Genomic Location (Zv9):
Chromosome 16 (position 58481341)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 55249197
GRCz11 16 54957222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGCCATGCTGTACGGAAACCGTGCTGCTGCATACATGAAGCGCAAGTG[G/A]TGAGACCAGACATTTTTTGATGATCCGCTTACATCAGCTTGTAAAGGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link