si:dkey-2j6.3

Ensembl ID:
ENSDARG00000059742
ZFIN ID:
ZDB-GENE-060526-292
Description:
Novel protein similar to vertebrate Rho guanine nucleotide exchange factor (GEF) 15 (ARHGEF15) [Sour
Human Orthologue:
ARHGEF15
Human Description:
Rho guanine nucleotide exchange factor (GEF) 15 [Source:HGNC Symbol;Acc:15590]
Mouse Orthologue:
Arhgef15
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 15 Gene [Source:MGI Symbol;Acc:MGI:3045246]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40581 Splice Site, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40581
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083386   None 365 None 10
ENSDART00000142744 Splice Site, Nonsense 431 516 9 11
Genomic Location (Zv9):
Chromosome 5 (position 63331243)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 53469933
GRCz11 5 54116526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCCATCAATTAATGAAACCTTTGGGGAGGAGAAGATTTATGAAGATTG[G/A]GGTGAGCTTGTGATTGTAACACTAGGGGGATATTGATGTAGTATTGTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link