zgc:152970

Ensembl ID:
ENSDARG00000059719
ZFIN ID:
ZDB-GENE-060825-117
Description:
hypothetical protein LOC751650 [Source:RefSeq peptide;Acc:NP_001038832]
Human Orthologue:
FAM169A
Human Description:
family with sequence similarity 169, member A [Source:HGNC Symbol;Acc:29138]
Mouse Orthologue:
Fam169a
Mouse Description:
family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1229 Essential Splice Site Available for shipment Available now
sa16026 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1229
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097466 Essential Splice Site 42 407 2 10
Genomic Location (Zv9):
Chromosome 5 (position 52772596)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50439792
GRCz11 5 51086385
KASP Assay ID:
554-1138.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCCATATAKAAAACCTGAGTACCTCATCCTGCCTAATTCCAAACAGG[T/C]AATATGGGAAAATGCCATATACTGATATAGTACCAAGTCTCTCTAAGAGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16026
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097466 Essential Splice Site 76 407 4 10
Genomic Location (Zv9):
Chromosome 5 (position 52773527)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50440723
GRCz11 5 51087316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGTTACCACWATCTGTTTTATGTGASRTTGAATTATATCTACTGTACA[G/A]TTGTAGGGCTTTATTTGCTGGGGAAGTGGTGGGGRGTTGAAGAGGTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link