vwa5b1

Ensembl ID:
ENSDARG00000059705
ZFIN ID:
ZDB-GENE-090313-299
Human Orthologue:
VWA5B1
Human Description:
von Willebrand factor A domain containing 5B1 [Source:HGNC Symbol;Acc:26538]
Mouse Orthologue:
Vwa5b1
Mouse Description:
von Willebrand factor A domain containing 5B1 Gene [Source:MGI Symbol;Acc:MGI:1922968]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3238 Nonsense F2 line generated During 2018
sa11957 Nonsense Available for shipment Available now
sa11799 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3238
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083289 Nonsense 917 1222 21 29
ENSDART00000146269   None 253 None 4
Genomic Location (Zv9):
Chromosome 23 (position 37297966)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 37097194
GRCz11 23 37199856
KASP Assay ID:
554-3369.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGTAATGACTCTTTGTGTGTTTGTTTATCTCTAGGGGAGGATCATAAA[C/T]RAAGCTCGCACTGTGGCTCTCGTTCYGGCAGCAGGAAGTCCCRTGGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11957
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083289 Nonsense 1124 1222 28 29
ENSDART00000146269   None 253 None 4
ENSDART00000083289 Nonsense 1124 1222 28 29
ENSDART00000146269   None 253 None 4
Genomic Location (Zv9):
Chromosome 23 (position 37318903)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 37118131
GRCz11 23 37220793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTCCACCGCGGCTCCTCGCCTCCTCCCASAGACTCCGATCTGAACTCT[G/T]AATGYGAGGATYTCATGTCCCRCAGCYCTCGGGTGGACGGCGAGCACTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11799
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083289 Nonsense 1124 1222 28 29
ENSDART00000146269   None 253 None 4
ENSDART00000083289 Nonsense 1124 1222 28 29
ENSDART00000146269   None 253 None 4
Genomic Location (Zv9):
Chromosome 23 (position 37318903)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 37118131
GRCz11 23 37220793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTCCACCGCGGCTCCTCGCCTCCTCCCASAGACTCCGATCTGAACTCT[G/T]AATGYGAGGATYTCATGTCCCRCAGCYCTCGGGTGGACGGCGAGCACTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link