
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-117c19.2
- Ensembl ID:
- ENSDARG00000059677
- ZFIN ID:
- ZDB-GENE-060526-16
- Description:
- MAM domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001123869]
- Human Orthologue:
- MAMDC2
- Human Description:
- MAM domain containing 2 [Source:HGNC Symbol;Acc:23673]
- Mouse Orthologue:
- Mamdc2
- Mouse Description:
- MAM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1918988]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12046 | Essential Splice Site | Available for shipment | Available now |
sa33721 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa40564 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa6065 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa13995 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12046
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083203 | Essential Splice Site | 11 | 680 | 2 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 56445868)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 51922138 GRCz11 5 52568731 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATTTAAAGCTTTATAGTTTGGCTTTATTGATGTGAKGTTCTGTSTCTTC[A/G]GCTGTGGCTCTTGTAGCGCGGTCTCAGACGCAGCTTTTGCGGGGCTCCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33721
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083203 | Nonsense | 87 | 680 | 3 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 56424775)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 51901045 GRCz11 5 52547638 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAAGTCCGGAGCTGGAGCTCAGAGACTGGAGCTGTGTGCGGCTGGTCTAT[C/T]AGATCTCAGGCTCAGGATCTCTTCAATTGCACTTGCGATCCGAGGAGGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40564
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083203 | Nonsense | 336 | 680 | 8 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 56403722)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 51879992 GRCz11 5 52526585 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATATCACTCATGTTTCAGAGCCAGAGATTGACCCGTCTGTTGCAAACTG[T/A]GACTTTGAGGAGGGCCTGTGTCAGTATTATCAGGAACAGACTGGAGGCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6065
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083203 | Nonsense | 538 | 680 | 11 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 56390239)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 51866509 GRCz11 5 52513102 - KASP Assay ID:
- 554-3846.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAAAAGGACATTGGCTAAGGATTCGAGGACAGACGCCCACATCTTACACC[G/T]GACCCAAGGGGGACCACACCTTAGGGGTAGGTGAGTCAGATTTATACTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13995
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083203 | Nonsense | 554 | 680 | 12 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 56390101)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 51866371 GRCz11 5 52512964 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AKYACACTAAGTTTCTCCTAYTCTGACTTCAAGGTTACTTCATGTACATT[G/T]AGGCCTCCCAYATGTTACCTAAGCAGTCAGCCCAGCTGATGTCCACTGAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: