
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:136763
- Ensembl ID:
- ENSDARG00000059672
- ZFIN ID:
- ZDB-GENE-060616-298
- Description:
- hypothetical protein LOC559813 [Source:RefSeq peptide;Acc:NP_001038371]
- Human Orthologue:
- ARHGAP6
- Human Description:
- Rho GTPase activating protein 6 [Source:HGNC Symbol;Acc:676]
- Mouse Orthologue:
- Arhgap6
- Mouse Description:
- Rho GTPase activating protein 6 Gene [Source:MGI Symbol;Acc:MGI:1196332]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34183 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa21070 | Nonsense | Available for shipment | Available now |
sa31595 | Essential Splice Site | Available for shipment | Available now |
sa45297 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa34183
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083189 | None | 630 | None | 13 | |
ENSDART00000130906 | Nonsense | 27 | 668 | 1 | 13 |
The following transcripts of ENSDARG00000059672 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 52916409)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 51186159 GRCz11 7 51461229 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAACCTCATCTGTAGTCATGCAGCCTGAGGACCCTGTTCGCCAGGACATG[C/T]AATTCTACTATGTGGTGAGTATAGGGGAATTACCTACAGTTGTATCATAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21070
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083189 | Nonsense | 180 | 630 | 5 | 13 |
ENSDART00000130906 | Nonsense | 218 | 668 | 5 | 13 |
The following transcripts of ENSDARG00000059672 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 52842947)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 51112697 GRCz11 7 51387767 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGGATGTCGGTGGACTCCATCTCTGATATGGTGGAGAGTCAGTCCAGAT[T/G]ACTAGAAGCTCTGCAGCTCTCTCACCCCAATGAGCTGGAGATGAAGAAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31595
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083189 | Essential Splice Site | 297 | 630 | 7 | 13 |
ENSDART00000130906 | Essential Splice Site | 335 | 668 | 7 | 13 |
The following transcripts of ENSDARG00000059672 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 52833806)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 51103556 GRCz11 7 51378626 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGACCCCCTCCTGCCACGAGAACTGTACCGGGCCTTCCTGCACGCTAACC[G/A]TACGAGCATATGATCATAAAGAAAAGCTCAATAAGTTCGAAGAGATCATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45297
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083189 | Nonsense | 574 | 630 | 12 | 13 |
ENSDART00000130906 | Nonsense | 612 | 668 | 12 | 13 |
The following transcripts of ENSDARG00000059672 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 52821067)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 51090817 GRCz11 7 51365887 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCATTTCACCCTGAGCCGGAAGGACAGCGGCTCTCAGCCACAGAGTCCT[C/T]GAGAGAAGGGCATCTGGGTACGACAGAACTCCAACGCCTCCTCCACCACC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: