zgc:136763

Ensembl ID:
ENSDARG00000059672
ZFIN ID:
ZDB-GENE-060616-298
Description:
hypothetical protein LOC559813 [Source:RefSeq peptide;Acc:NP_001038371]
Human Orthologue:
ARHGAP6
Human Description:
Rho GTPase activating protein 6 [Source:HGNC Symbol;Acc:676]
Mouse Orthologue:
Arhgap6
Mouse Description:
Rho GTPase activating protein 6 Gene [Source:MGI Symbol;Acc:MGI:1196332]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34183 Nonsense Mutation detected in F1 DNA During 2018
sa21070 Nonsense Available for shipment Available now
sa31595 Essential Splice Site Available for shipment Available now
sa45297 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083189   None 630 None 13
ENSDART00000130906 Nonsense 27 668 1 13

The following transcripts of ENSDARG00000059672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 52916409)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51186159
GRCz11 7 51461229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCTCATCTGTAGTCATGCAGCCTGAGGACCCTGTTCGCCAGGACATG[C/T]AATTCTACTATGTGGTGAGTATAGGGGAATTACCTACAGTTGTATCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21070
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083189 Nonsense 180 630 5 13
ENSDART00000130906 Nonsense 218 668 5 13

The following transcripts of ENSDARG00000059672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 52842947)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51112697
GRCz11 7 51387767
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGATGTCGGTGGACTCCATCTCTGATATGGTGGAGAGTCAGTCCAGAT[T/G]ACTAGAAGCTCTGCAGCTCTCTCACCCCAATGAGCTGGAGATGAAGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083189 Essential Splice Site 297 630 7 13
ENSDART00000130906 Essential Splice Site 335 668 7 13

The following transcripts of ENSDARG00000059672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 52833806)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51103556
GRCz11 7 51378626
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACCCCCTCCTGCCACGAGAACTGTACCGGGCCTTCCTGCACGCTAACC[G/A]TACGAGCATATGATCATAAAGAAAAGCTCAATAAGTTCGAAGAGATCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45297
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083189 Nonsense 574 630 12 13
ENSDART00000130906 Nonsense 612 668 12 13

The following transcripts of ENSDARG00000059672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 52821067)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51090817
GRCz11 7 51365887
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATTTCACCCTGAGCCGGAAGGACAGCGGCTCTCAGCCACAGAGTCCT[C/T]GAGAGAAGGGCATCTGGGTACGACAGAACTCCAACGCCTCCTCCACCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link