zgc:153516

Ensembl ID:
ENSDARG00000059629
ZFIN ID:
ZDB-GENE-061103-142
Description:
Aspartate beta-hydroxylase domain-containing protein 2 [Source:UniProtKB/Swiss-Prot;Acc:A0JMH0]
Human Orthologue:
ASPHD2
Human Description:
aspartate beta-hydroxylase domain containing 2 [Source:HGNC Symbol;Acc:30437]
Mouse Orthologue:
Asphd2
Mouse Description:
aspartate beta-hydroxylase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1920148]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16978 Nonsense Available for shipment Available now
sa21353 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa16978
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083066 Nonsense 105 371 2 4
ENSDART00000140127   None 87 None 2
ENSDART00000141707   None 178 None 2
Genomic Location (Zv9):
Chromosome 8 (position 41929856)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39943436
GRCz11 8 39977210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGGAGGAGGTGGAGTCAGTGATGAAGAACTCAATGGGTTTGCCTACTG[C/A]CAGTCCTCAGAATGCTTCCGGTGCACYAAACCTGGTGAAGGCCTGAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21353
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083066 Essential Splice Site 335 371 3 4
ENSDART00000140127   None 87 None 2
ENSDART00000141707 Missense 170 178 2 2
Genomic Location (Zv9):
Chromosome 8 (position 41927430)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39941010
GRCz11 8 39974784
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTGCCTGCTGTTCGATGACTCTTTTCTTCACACTGCATTTCATGATG[G/A]TGAGAAAGACAAACAATGCATTGCCTAAATGTAATAGATAGTAGAGCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link