ubfd1

Ensembl ID:
ENSDARG00000059622
ZFIN ID:
ZDB-GENE-050506-90
Description:
ubiquitin domain-containing protein UBFD1 [Source:RefSeq peptide;Acc:NP_001076299]
Human Orthologues:
AC104771.1, UBFD1
Human Description:
ubiquitin family domain containing 1 [Source:HGNC Symbol;Acc:30565]
Mouse Orthologue:
Ubfd1
Mouse Description:
ubiquitin family domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:107301]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33285 Nonsense Mutation detected in F1 DNA During 2018
sa40141 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083053 Nonsense 67 279 2 7
ENSDART00000124026 Nonsense 78 290 2 7
ENSDART00000147777 Nonsense 67 153 2 3
Genomic Location (Zv9):
Chromosome 3 (position 42656156)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 43252849
GRCz11 3 43953766
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGGAAAGAGATGGTGGACGTGAAAATCATTTGGAACAAAAACAAATA[T/A]GATCTTAAAATCCCTTTAGATGGCACCGGTGCCAAGCTGAAAGAGAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083053 Nonsense 254 279 7 7
ENSDART00000124026 Nonsense 265 290 7 7
ENSDART00000147777   None 153 None 3
Genomic Location (Zv9):
Chromosome 3 (position 42667554)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 43241451
GRCz11 3 43942368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTGTTTGTCACTCCAGGCATTTCAGCTGGGTCCGACAGAAGCCTCA[C/T]AATATTGGGTCTACTGGGTGCCTGCACAGTTTGTTGATGCAATCAAAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link